DeltaSplice

Reference-informed prediction of alternative splicing and splicing-altering mutations from sequences.

Disclaimer

This is an UNOFFICIAL implementation of Reference-informed prediction of alternative splicing and splicing-altering mutations from sequences by Chencheng Xu, Suying Bao, et al.

The OFFICIAL repository of DeltaSplice is at chaolinzhanglab/DeltaSplice.

The MultiMolecule team has confirmed that the provided model and checkpoints are producing the same intermediate representations as the original implementation.

The team releasing DeltaSplice did not write this model card for this model so this model card has been written by the MultiMolecule team.

Model Details

DeltaSplice predicts splice-site usage (SSU) and splicing-altering mutation effects from sequence. The model uses a valid-convolution dilated residual encoder and three prediction modules: splice-site usage, reference-informed delta-SSU, and an auxiliary splice-site head. The official package uses the average prediction of five checkpoints for SSU and delta-SSU prediction; MultiMolecule stores the five seed checkpoints of each released data variant as internal ensemble members and returns their average prediction.

Variants

Model Specification

Variant Num Layers Hidden Size Context Ensemble Members Num Parameters (M) FLOPs (M) MACs (M)
DeltaSplice 24 64 30000 5 40.376 1642965.72 820284.36
DeltaSplice-Human 24 64 30000 5 40.376 1642965.72 820284.36

(FLOPs and MACs measured on one requested output nucleotide with the default 30 kb padded context.)

Links

Usage

The model file depends on the multimolecule library. You can install it using pip:

pip install multimolecule

Direct Use

Splice-Site Usage

>>> from multimolecule import RnaTokenizer
>>> from multimolecule.models.deltasplice import DeltaSpliceModel

>>> tokenizer = RnaTokenizer.from_pretrained("multimolecule/deltasplice")
>>> model = DeltaSpliceModel.from_pretrained("multimolecule/deltasplice")
>>> inputs = tokenizer("AGCAGUCAUUAUGGCGAAUCUGGCAAGUA", return_tensors="pt")
>>> output = model(**inputs)
>>> output["probabilities"].shape
torch.Size([1, 30, 3])

Variant Effect

>>> from multimolecule import RnaTokenizer
>>> from multimolecule.models.deltasplice import DeltaSpliceModel

>>> tokenizer = RnaTokenizer.from_pretrained("multimolecule/deltasplice")
>>> model = DeltaSpliceModel.from_pretrained("multimolecule/deltasplice")
>>> reference = tokenizer("AGCAGUCAUUAUGGCGAAUCUGGCAAGUA", return_tensors="pt")
>>> alternative = tokenizer("AGCAGUCAUUAUGGCUAAUCUGGCAAGUA", return_tensors="pt")
>>> output = model(reference["input_ids"], alternative_input_ids=alternative["input_ids"], use_reference=True)
>>> output["delta"].shape
torch.Size([1, 30, 3])

Interface

  • Input: RNA sequence tokenized with RnaTokenizer; N is encoded as zero nucleotide channels
  • Output channels: no_splice, acceptor, donor
  • Reference-only call: returns per-position splice-site usage probabilities in probabilities
  • Reference + alternative call: pass the reference sequence as input_ids and the alternate sequence as alternative_input_ids
  • Reference usage: pass reference_usage with shape (batch_size, sequence_length, 3) or omit it to use the model's own reference usage as the reference signal

Training Details

DeltaSplice was trained to predict splice-site usage from gene sequence and to improve mutation-effect prediction by incorporating reference splice-site usage.

Training Data

The upstream repository describes training from gene_dataset.tsu.txt, which contains splice-site usage in adult brains of eight mammalian species.

Training Procedure

The official release provides five seed checkpoints with the same architecture and data split. MultiMolecule represents these seed checkpoints as internal ensemble members rather than public model variants.

Citation

@article{xu2024deltasplice,
  title     = {Reference-informed prediction of alternative splicing and splicing-altering mutations from sequences},
  author    = {Xu, Chencheng and Bao, Suying and Wang, Ye and Li, Wenxing and Chen, Hao and Shen, Yufeng and Jiang, Tao and Zhang, Chaolin},
  journal   = {Genome Research},
  volume    = {34},
  number    = {7},
  pages     = {1052--1065},
  year      = {2024},
  doi       = {10.1101/gr.279044.124}
}

The artifacts distributed in this repository are part of the MultiMolecule project. If MultiMolecule supports your research, please cite the MultiMolecule project as follows:

@software{chen_2024_12638419,
  author    = {Chen, Zhiyuan and Zhu, Sophia Y.},
  title     = {MultiMolecule},
  doi       = {10.5281/zenodo.12638419},
  publisher = {Zenodo},
  url       = {https://doi.org/10.5281/zenodo.12638419},
  year      = 2024,
  month     = may,
  day       = 4
}

Contact

Please use GitHub issues of MultiMolecule for any questions or comments on the model card.

Please contact the authors of the DeltaSplice paper for questions or comments on the paper/model.

License

This model implementation is licensed under the GNU Affero General Public License.

For additional terms and clarifications, please refer to our License FAQ.

SPDX-License-Identifier: AGPL-3.0-or-later
Downloads last month
90
Safetensors
Model size
40.4M params
Tensor type
F32
·
Inference Providers NEW
This model isn't deployed by any Inference Provider. 🙋 Ask for provider support